BioCorp

Ordering

Chose your Card

You may order by fill-in form, by Email or by fax.
We have also provided a printable IUB Code chart for your convenience.
Below are some examples on how to enter orders. These apply to all ordering methods, online, email, and fax.


Modifications:

Regular bases, Inosine:

Enter sequences 5′to 3′, upper or lower case. Inosine is ‘ i ’, and may not be in the 3′ position:
5′ggttataccatacciccAGATTTTCTCggaItta3′

Mixed Bases:

The sequence may be entered using IUB codes, or with the bases in brackets, or both. There is no extra charge for mixed bases in the 3′ position.
5′GG(AT)aacccwgg(ag)ggNNCCYGA(GCT)ctta3′

Phosphorothioate:

the linkages to be phosphorothioated should be noted with an asterisk:
5′G*G*C*C*GGATTTATGGCGAATTAGATT*T*A*T*G3′

Or, if the entire oligo is to be phosphorothioate, just note this in the modifications.

5′ or 3′ Modifications:

Aminolink, Biotin, Phosphate, etc. You only need to note these in the modifications box.


Back to Top

Scale

Oligos may be ordered at 50 nm, 200 nm, or 1 µm scale. Alternately, arrangements can be made for a specific yield, if, for example you require a specific number of milligrams or OD units of primer.

The scale of synthesis refers to the amount of material on the synthesis column.

Back to Top

Purity

We offer 4 levels of purity: Standard, OPC, PAGE, and HPLC. Standard oligos are low-salt and suitable for most uses. The exception being labeling with T4PNK. For which we recommend resuspending the oligo in water and drying down once before use.

We recommend HPLC purification for labelled oligos. For dual-labeled oligos, HPLC is required. Please consult our chart.

Back to Top

Length

We have successfully made oligos up to 300 bases. There is no additional cost for long oligos, but we can't guarantee any oligos over 100 bases. Careful experiment design goes a long way towards avoiding the effect of failure sequences. For example, oligos are made 3′ to 5′ so if the experiment can select for oligos with an intact 5′ end, longer oligos may be used.

With proper design, if the experiment allows, 100nt oligos may be used unpurified.

Back to Top

On to the order form...

Last modified: Wed September 12 2007 01:31:38 PM
You are using CCBot/1.0 (+http://www.commoncrawl.org/bot.html)
BioCorp®  is a registered trademark. Copyright © 2009, BioCorp DNA Inc..